+27

El mundo del cine y la televisión, en las últimas décadas, ha cambiado nuestra forma de vida y entretenimiento, logrando trasladarnos a lugares que jamás imaginaríamos, ya sean ficticios o reales. Tanto es así, que si nos hablan, por ejemplo, de la escena de un crimen, a pesar de no haber presenciado nunca ninguna, probablemente todos seamos capaces de imaginar la situación de una forma muy parecida. Condicionados por la perspectiva americana, todos visualizamos al inspector trajeado de aspecto serio, quitándose las gafas de sol mientras analiza en silencio la escena, al tiempo que la policía científica toma muestras de la víctima, que más tarde se transformarán en pruebas cruciales para la resolución del caso. Lo que normalmente no explican en las películas es qué hacen con esas muestras, cómo las procesan, por qué son tan importantes o desde cuándo llevan utilizándose.

En este sentido, y a pesar de que ya se aplicaban algunos métodos, un punto de inflexión en el uso de herramientas científicas de forma definitiva en ciencia forense tiene como responsable al científico Alec Jeffreys. Este genetista británico desarrolló una técnica llamada “huella genética”, que entre otros, permitió resolver los crímenes de Pitchfork, un doble caso de violación y asesinato. Ahora bien, antes de entrar en los detalles del sumario, debemos conocer cómo funciona la técnica que desarrolló Jeffreys.

Para ello, lo primero es conocer y familiarizarse con el ADN, la molécula con la que trabajaba Jeffreys y en la que basó su técnica. El ADN es una molécula que todos tenemos en nuestras células y que recoge la información de lo que somos, nuestros genes. Esta información está escrita en un código de cuatro letras distintas (A, C, G y T) y en longitud, nuestro ADN tiene aproximadamente 3.000.000.000 de letras en total, ordenadas como una secuencia, por ejemplo:

5´-…ACGTGTCAGTCATCGATCTATAGCTAGCTA…- 3´

El código anterior podría ser el fragmento de uno de nuestros genes. Aunque a simple vista no se entiende, y puedan parecen combinaciones de las cuatro letras al azar, constituye el idioma que utiliza el ADN en toda su extensión. No obstante, hay regiones en nuestro ADN en las que las combinaciones de estas cuatro letras dejan de ser aleatorias, apareciendo por ejemplo:

Huella genética

En esta región de nuestro ADN, la distribución de letras parece seguir un patrón. Si nos fijamos, la secuencia completa no es más que la repetición del fragmento “ACGTCT” cinco veces. A los fragmentos que se repiten se les llama “minisatélites”. He escogido el número cinco por no hacerlo innecesariamente extenso, pero en nuestras células este número es variable y puede incluir desde unas 10 hasta 1.000 repeticiones de una misma secuencia. Precisamente de eso se dio cuenta nuestro ya conocido Jeffreys, quien observó que el número de repeticiones de una determinada secuencia de ADN era distinto y específico de cada individuo, lo que permitía identificarlo, como si de sus huellas dactilares se tratara.

Es preciso añadir que en nuestro ADN tenemos miles de minisatélites distintos, y que además, no solo son variables en el número de repeticiones que presentan, sino también en la longitud de los mismos y en las secuencias que contienen. Existen repeticiones de fragmentos más largos, a los que sencillamente se les llama satélites y también repeticiones de otros más cortos, conocidos como microsatélites. Como vemos, las posibilidades son enormes en un código de tres mil millones de letras.

Pero volvamos a los hallazgos de Jeffreys. Como ya hemos dicho, este científico se dio cuenta de que el número de repeticiones de los minisatélites podría servir para identificar a una persona concreta, al ser un rasgo específico de cada individuo. La técnica que desarrolló se basó en esta hipótesis y para explicarla utilizaremos un ejemplo.

Supongamos que tenemos una muestra de ADN y queremos confirmar si procede de una persona llamada X. Para ello, procederemos a tomar una muestra de ADN de X y estudiaremos el número de los minisatélites de ambas muestras. En este caso, digamos que seleccionamos tres minisatélites de diferentes zonas de su ADN para el estudio. En primer lugar, se utiliza una proteína que permite cortar el ADN y quedarnos únicamente con las zonas de interés, las que contienen los minisatélites seleccionados. A continuación, tiene lugar una electroforesis y con la ayuda de una sonda, se realiza un análisis de Southern.

Pero no nos perdamos en los detalles, esto no es más que una técnica, representada en la parte inferior de la imagen, que permite conocer el tamaño de varias moléculas de ADN (en este caso las muestras de los minisatélites) a través de las bandas negras que se reflejan. Cada una de las bandas que se observa equivale a cada uno de los minisatélites que aparece a su lado. Pero en lo que debemos fijarnos es en la posición de cada banda. En una electroforesis, las moléculas de mayor tamaño quedan situadas en la parte superior, mientras que las más pequeñas se encuentran en la parte inferior. Por tanto, aquellas que compartan tamaño, o en este caso, número de repeticiones de cada minisatélite, se encontrarán a la misma altura.

Huella genética

Los resultados de esta técnica permiten observar cómo las bandas no coinciden exactamente unas con otras, indicando que los minisatélites estudiados no son exactamente iguales en ambas muestras. De esto se deduce, por tanto, que la muestra de ADN que teníamos no proviene del sospechoso X, ya que, de ser así, al comparar dos muestras con el ADN de la misma persona, deberíamos observar un patrón de bandas idéntico para cada uno de los minisatélites estudiados.

Quizás ha observado, de forma acertada, que las bandas del minisatélite 2 sí que coinciden en ambas muestras. Por lo que, si en lugar de haber escogido tres minisatélites distintos, hubiéramos decidido realizar el estudio seleccionando únicamente el minisatélite 2, habríamos concluido que ambas muestras son iguales y que la que teníamos procede del individuo X. Por ello, y para evitar que puedan darse coincidencias que induzcan a conclusiones erróneas, en la realidad los estudios se realizan utilizando un gran número de minisatélites. En concreto, en el caso de los crímenes de Pitchfork se estudiaron cerca de 30, garantizando que la probabilidad de error en el análisis fuera prácticamente cero.

Fue una mañana de 1984 en Leicester, cuando Alec Jeffreys advirtió que los métodos con los que trabajaba podrían servir para discriminar de forma inequívoca entre personas. Tan solo un año antes, la adolescente Lynda Mann había sido violada y asesinada sin que se lograra identificar al responsable. Y tres años después, en 1986, una segunda adolescente, Dawn Ashworth sería víctima de los mismos trágicos sucesos. Los agentes del caso encontraron en Richard Buckland a su principal sospechoso, ya que alegaba ser el responsable del segundo crimen, pero aseguraba no estar involucrado en el primero. Sin embargo, la policía, convencida de que ambos sucesos se habían perpetrado por un mismo autor, acudió a Alec Jeffreys, quien hizo uso de su técnica para esclarecer el caso.

A través del estudio del ADN obtenido de las muestras de semen recogidas de ambas víctimas, Jeffreys confirmó que se trataba del mismo autor, al observar que los minisatélites de ambas muestras contenían un número idéntico de repeticiones. Además, comparándolas con otra tomada de Buckland, comprobó que las bandas de sus minisatélites no coincidían con las de las muestras tomadas de las víctimas, quedando descartada por tanto su posible autoría.

Pitchfork

Finalmente, tras ponerse en marcha un gran proceso de toma de muestras entre la población de la zona, se encontró una que reflejaba un patrón de bandas idéntico al de las muestras de las víctimas, es decir, cuyos minisatélites tenían las mismas repeticiones. Esta muestra procedía de Colin Pitchfork, que fue arrestado y confesó ambos crímenes. Más tarde, sería condenado a cadena perpetua, convirtiéndose así en la primera sentencia penal basada en pruebas forenses de ADN.

 

Bibliografía:

http://www.dnaforensics.com/DNAFingerprinting.aspx

https://www.genome.gov/es/genetics-glossary/Huella-genetica

https://es.wikipedia.org/wiki/Alec_Jeffreys

https://web.archive.org/web/20061214004903/http://www.forensic.gov.uk/forensic_t/inside/news/list_casefiles.php?case=1

+27

Únete a la comunidad

Más de 11.824 personas se han unido a nuestra newsletter. Prometemos enviarte sólo cosas interesantes.

POLITICA_PRIVACIDAD

Gracias por suscribirte.

Share This